FEAST: Fast Empirical Algorithms Suggesting Transcripts

This page contains supplementary information for the manuscript published in PLoS Computational Biology 2(3): e18, March 2006.

A custom FEAST track for the UCSC browser

Create a bookmark in your browser, pointing at the July 03 FEAST custom track.
Then, when viewing any region in the human genome via the UCSC genome browser, select that bookmark to add the FEAST predictions to your display. You'll typically need to do this just once per session.
Important: this custom track refers to the July 2003 human genome freeze (hg16). Here's a preliminary hg18 (March 2006) FEAST custom track.

Re-analysis of gene annotations

We used FEAST to score the genomic regions defined by existing annotations from the following tracks: In these gzipped, tab-delimited files, the columns represent: transcript identifier, chromosome, start, end, strand, FEAST score. All coordinates refer to the July 03 freeze. Start coordinates are zero-based, end coordinates are one-based.

Primer list

Here is the list of primers that were used for amplification and sequencing of the three novel genes described in the paper.
Primer pair Direction Sequence Tm
CPHL1-1 F GGGTCCAGTGGTATTTTGTTGGCATGGGTGGCGTGG 69.6 ℃
R AGGGTGGAGGGGTACGCAGTCCAGGAGGCTGA 71.7 ℃
AGBL1-1 F GCCAGACGCTGGGAGGGAATCCGTGTCCCTTG 70.3 ℃
R GGACACCCCCATCTCTCTCCACACCACCACCCG 70.7 ℃
LOC401237-1 F TGAACTCTCTTTCCTCCCCTCTCCCCCGGACGCC 70.9 ℃
R GTGGCGTGCTTCGGGCAGGGCTACATGCTTGG 71.2 ℃
LOC401237-2 F CCGGACGCCGGGGTATCTCCCTCTCGCAACT 71.2 ℃
R TCACGCTCTCCGTGGGTGAAGGGAAGTGGGCTC 70.5 ℃

Back to the main FEAST page.